We're unable to sign you in at this time. Please try again in a few minutes.
We were able to sign you in, but your subscription(s) could not be found. Please try again in a few minutes.
There may be a problem with your account. Please contact the AMA Service Center to resolve this issue.
Contact the AMA Service Center:
Telephone: 1 (800) 262-2350 or 1 (312) 670-7827  *   Email: subscriptions@jamanetwork.com
Error Message ......
Original Article |

In Vitro Effects of Acid and Pepsin on Mouse Middle Ear Epithelial Cell Viability and MUC5B Gene Expression FREE

Bradley B. Block, MD; Elaine Kuo, DVM, MS; Habib G. Zalzal, BA; Hugo Escobar, MD; Mary Rose, PhD; Diego Preciado, MD, PhD
[+] Author Affiliations

Author Affiliations: Department of Otolaryngology–Head and Neck Surgery, Georgetown University (Drs Block, Rose, and Preciado), and Center for Genetic Medicine Research (Drs Kuo, Escobar, Rose, Preciado, and Mr Zalzal) and Divisions of Pediatric Pulmonary Medicine (Drs Escobar and Rose) and Pediatric Otolaryngology–Head and Neck Surgery (Dr Preciado), Children's National Medical Center, Washington, DC.

Arch Otolaryngol Head Neck Surg. 2010;136(1):37-42. doi:10.1001/archoto.2009.199.
Text Size: A A A
Published online

Objective  To examine whether in vitro exposure of mouse middle ear epithelial cells (mMEECs) to conditions that mimic physiologic reflux upregulates Muc5b gene expression and alters cell viability.

Design  In vitro mMEEC model.

Setting  Center for Genetic Medicine Research, Children's National Medical Center, Washington, DC.

Participants  Cells from the immortalized mMEEC line.

Main Outcome Measures  Cell viability, the quantity of Muc5b messenger RNA abundance, and Muc5b promoter activity.

Results  The 3-(4,5-dimethylthiazoyl-2-yl)-2,5-diphenyltetrazolium bromide assays demonstrated an acidic dose-dependent decrease in cell survival, with pH less than 4 significantly decreasing viability at 1 hour. Pepsin had a mild protective effect up to 8 hours, with greater cell viability, in the pH range of 5.0 to 7.6. Reverse-transcriptase polymerase chain reaction demonstrated induction of Muc5b messenger RNA levels over controls after exposure to acidic pH levels of 5.7, and 4 with and without pepsin. Similarly, a pH of 4.0 significantly increased Muc5b promoter activation 5.4-fold. Pepsin at neutral or acidic pH values did not significantly alter Muc5b expression or promoter activity.

Conclusions  Despite decreasing cell viability, acidic pH drives middle ear epithelial Muc5b gene expression in vitro, which perhaps explains how laryngopharyngeal reflux can contribute to otitis media. Pepsin at neutral or acidic pH levels had minimal effects on Muc5b gene expression; thus, although pepsin may be a useful marker for detecting the presence of reflux, our results suggest that acid itself is a more likely pathologic component of gastric juice in the middle ear.

Figures in this Article

Otitis media (OM) is the most commonly diagnosed pediatric illness and indication for antibiotics in children in the United States.1 It is the most common cause of pediatric hearing loss. There are multiple pathophysiologic mechanisms that may contribute to the development of OM with effusion, such as eustachian tube dysfunction and obstruction, bacterial infection and biofilms, respiratory tract viruses, adenoid disease, allergy, and, most recently, laryngopharyngeal reflux.2,3 Pepsin is a proteinase stored as inactive pepsinogen in the chief cells of gastric mucosa and activated by a pH less than 4.5.4 In a seminal study, Tasker et al2 used an enzyme-linked immunosorbent assay with an antipepsin antibody to identify pepsin in middle ear aspirates of children with OM with effusion. They found 59 of 65 effusions to be pepsin positive at concentrations that were 1000 times higher than that of pepsinogen in serum. Since then, these findings have been duplicated multiple times, using different antibodies5 and enzymatic assays.6 In the largest study to date, primarily using immunoblotting of middle ear aspirates compared with gastric juice, O’Reilly et al7 confirmed the presence of pepsin in the middle ear of children with recurrent acute OM and OM with effusion, with 20% of patients having pepsin-positive status, in contrast to 1.5% of control individuals.

Despite these mostly co-relational findings, causal mechanisms by which reflux may contribute to the development of middle ear effusion have yet to be elucidated. Diseased middle ears frequently show evidence of mucosal metaplasia with an increased concentration of goblet cells.8 The viscosity of mucus is regulated by mucins, a family of glycoproteins whose protein backbones are characterized by numerous tandem repeats that contain proline and are high in serine and/or threonine residues, the sites of O-glycosylation. They can be classified as either membrane bound, in which they are anchored directly to the bilayer of the cell membrane, or secretory, in which they lack a transmembrane domain and are synthesized as monomers and posttranscriptionally polymerized to form dimers or trimers that comprise a protective mucous layer.911 The predominant mucin glycoprotein upregulated in OM appears to be MUC5B, a relatively large, high-viscosity secretory mucin.1214 Although mucins in the respiratory tract function primarily to help maintain mucociliary clearance, interact with pathogens, and protect the epithelium, within the confines of the middle ear9,11 their overproduction may result in mucous obstruction or stagnation, thus contributing to OM disease.15,16 In the esophagus, the presence of stomach acids and bile salts is known to influence the rate of mucin gene expression.17,18 Similarly, expression of another secretory airway mucin, MUC5AC, is reported to be induced by acidic pH in laryngeal airway epithelium.19 Further, gastroesophageal reflux has been shown to impair normal mucociliary function in nasal and upper airway epithelium.20 Finally, animal models that simulate gastric juice upper airway exposure have demonstrated that reflux impairs mucociliary function and increases mucous production.21,22 We therefore hypothesized that a mechanism by which laryngopharyngeal reflux may contribute to OM is the upregulation of the genetic expression of the predominant OM mucin, MUC5B, in middle ear epithelium.

This hypothesis was tested in an in vitro mouse middle ear epithelial cell (mMEEC) model by exposing cells to media with acidic pH and subsequently measuring cell viability, the quantity of Muc5b messenger RNA (mRNA) abundance, and Muc5b promoter activity. The pathogenic contribution of pepsin was assessed by the stimulation of cells at each experimental parameter with and without pepsin.


Immortalized mMEEC lines23,24 were provided by Jizhen Lin, MD (University of Minnesota, Minneapolis). The cells are immortalized by temperature-sensitive simian virus 40 and are thus programmed to proliferate at 33°C and differentiate at 37°C.23 The cells were grown in full growth media (FGM) and maintained as previously described.24 Before experimentation, cells were transferred to a 37°C, 5% carbon dioxide humidified atmosphere in serum-free media. Cells were then grown on plastic or on permeable supports (Transwells; Corning Inc, Corning, New York) submerged in FGM until they achieved confluence. For some experiments, cells were grown at an air-liquid interface (ALI) for 14 days in serum-free media. Stimulants were supplied only to the basal side of the cells. These ALI conditions have been reported to further differentiate middle ear cells, with diffuse formation of goblet cells, mimicking in vivo OM metaplastic epithelium.25

For experimental stimulation, acidic pH was established by adjustment of serum-free FGM with 1M sodium hydroxide and/or hydrochloride to the appropriate pH before sterile filtering the media through a 40-μm filter. For some experiments, porcine pepsin (Sigma-Aldrich Corporation, St Louis, Missouri) was then added to the media at a final dose of 2 mg/mL, and the pH was retitrated to ensure no measurable difference in the set pH level.


Before testing for pH-induced mucin production, the lowest pH at which in vitro mMEECs remain metabolically active had to be established. This has been previously reported in esophageal epithelia26 but not middle ear epithelia. Cells were passaged onto 96-well plates and grown at 33°C in a 5% carbon dioxide humidified atmosphere for 48 hours before the medium was changed to serum-free media in 37°C. The mMEECs were exposed to a pH of 3.0 to 5.5 at intervals of pH 0.5, with a control of 7.6 (the pH of serum-free media), for 1, 2, 4, and 8 hours, with and without 2 mg/mL of porcine pepsin (Sigma-Aldrich Corporation), 6 wells per condition. The 3-(4,5-dimethylthiazoyl-2-yl)-2,5-diphenyltetrazolium bromide (MTT) colorimetric assay (Sigma-Aldrich) was then performed.


Before acid exposure, mMEECs were grown at an ALI for 14 days to allow for differentiation.25 During this time, media were changed every 2 to 3 days. Once differentiated, the cells were exposed to pHs of 4.0, 5.7, and 7.6 for 30 minutes. The acidic media was then removed, and cells were kept in serum-free media for 2 and 8 hours before harvesting RNA by means of TRIzol (Life Technologies Corporation, Carlsbad, California). This short bolus of acidic exposure has been used previously to study epithelial mucin gene activation effects.19 RNA was precipitated with isopropyl alcohol, washed, and dissolved in ribonuclease-free water. Reverse-transcriptase polymerase chain reaction (RT-PCR) was then performed, as described previously.24 Generated complementary DNA was then used for real-time RT-PCR, by the use of specific pairs of primers as follows: Muc5b forward primer, 5′-ACTTGAGGAGGGTTCCAGGT-3′ and Muc5b reverse primer, 5′-ACAGTGCCAGGGTTTATGC-3′ (GenBank accession No. AJ311906). As an internal control, β-actin was used, and primers for mouse β-actin were obtained from Gene Link (Hawthorne, New York). The 307 and 349 base pairs (bp) are Muc5b and β-actin PCR amplicons, respectively. Real-time RT-PCR was performed on the generated complementary DNA products in a sequence detection system (ABI Prism 7700; Applied Biosystems Inc, Foster City, California) by means of a master mix (Power SYBR Green PCR Master Mix; Applied Biosystems Inc). As an internal control for normalizing Muc5b mRNA levels in control and experimental samples, β-Actin was used. Relative quantification of Muc5b mRNA in control and experimental samples was obtained by means of the standard curve method.


The promoter sequence for Muc5b was identified on GenBank as accession No. AY744445. The following primers tagged with 5′ restriction enzyme sequences were obtained from Integrated DNA Technologies (Coralville, Iowa): F – 1785 5′GACTCTCGAGGGATCCTCAAGGCCCAC T 3′ and R + 47 5′GACTAAGCTTCCTGGGGGCAGTACAGA3′ (XhoI restriction sites on the F primers' 5′ end and HindIII restriction site on the R primer 5′ end). We performed PCR using these primers and mouse liver genomic DNA as the template. After purification, resulting products were restricted and ligated to the PGL3 vector (Promega, Madison, Wisconsin). After confirmation of the nucleotide sequences, the −1785-bp nucleotide Muc5bLuc promoter plasmid (−1785Muc5bLuc) was then transformed in competent DH5α cells and amplified (MaxiPrep kits; Promega).


−1785Muc5bLuc or PGL3 (empty vector) reporter plasmids were transiently transfected into mMEECs for luciferase assays as follows. Cells were passaged onto plastic 12-well plates (Fisher Scientific, Pittsburgh, Pennsylvania) in FGM and grown at 33°C in a 5% carbon dioxide humidified atmosphere. Once 80% confluent, they were transferred to a 37°C, 5% carbon dioxide humidified atmosphere in serum-free media. Cells were cotransfected with the luciferase plasmids (1 μg/mL) and a pCMV-βGal reporter construct (0.1 μg/mL) (Clontech Laboratories Inc, Mountainview, California) in Opti-MEM medium containing 3 μg/mL of Lipofectamine 2000 (Life Technologies Corporation). After 16 hours, the medium was removed and the cells were stimulated for 30 minutes with serum-free media that had been adjusted to acidic pH. The pH values of 7.6, 6.0, 5.0, and 4.0 were used, with and without 2 mg/mL of porcine pepsin. The media were then switched to serum-free media for 7.5 hours. Cell lysates were then procured by scraping the cells in lysis buffer (Applied Biosystems Inc) supplemented with 0.5mM dithiothreitol. The relative luciferase activity was determined with the dual light reporter gene assay kit (Tropix Inc, Medford, Massachusetts) and a Monolight 2010 plate luminometer (Analytical Luminescence Laboratory, San Diego, California) according to the instructions of the manufacturers. Results for relative luciferase units were determined as a count ratio of the −1785Muc5bLuc construct over the pCMV-βGal reporter to normalize for transfection efficiency and subsequently normalized by background empty vector PGL3/pCMV-βGal counts for each experimental condition.


The statistical difference between the experimental and control groups for all experiments was determined by 2-tailed t tests. Significance level was set at P < .05.


The mMEECs were exposed to pH levels of 3.0 to 5.5 at intervals of 0.5, with a control of 7.6, the pH of media, at 1, 2, 4, and 8 hours, with and without 2 mg/mL of porcine pepsin. There was a direct proportion between pH and measured cell viability, with decreasing pH decreasing cell viability in a dose-dependent fashion (Figure 1A and B). Pepsin had a mild protective effect, with greater cell viability, in the pH range of 5.0 to 5.5 (Figure 1C) and in the control pH of 7.6. A pH of less than 4.0 was essentially lethal to the cells by 2 hours, so the lower limit of further experimentation was set at a pH of 4.0, the pH at which esophageal pH probes for reflux are considered to be positive. Acidic pH increases expression of Muc5b in a primary immortalized murine middle ear cell line grown under differentiating conditions.

Place holder to copy figure label and caption
Figure 1.

Effect of pH on cell viability. A, 3-(4,5-dimethylthiazoyl-2-yl)-2,5-diphenyltetrazolium bromide colorimetric assay performed on mouse middle ear epithelial cells after exposure to acidic pH at 1, 2, 4, and 8 hours. B, The identical experiment was performed but with 2 mg/mL of porcine pepsin added. Results showed increased metabolic activity compared with acid alone at most pH levels, which implies a protective effect of pepsin. C, Data from panels A and B for pH 5.0 and 5.5, set apart to more clearly illustrate the protective effect of pepsin.

Graphic Jump Location

Stimulation of ALI-differentiated mMEECs with pH 4.0 and 5.5 did not have a statistically significant effect on Muc5b expression after 2 hours, with only 1.2- and 1.8-fold increases over neutral pH, respectively (data not shown). After 8 hours, however, a statistically significant dose-response acid effect was seen on Muc5b mRNA production, with a 1.9-fold and 5.8-fold increase over neutral pH control with pH 5.7 and 4, respectively (P = .002 and P = .03, respectively) (Figure 2A). Addition of 2 mg/mL of porcine pepsin mitigated the acid effect at pH 4 but enhanced the effect at pH 5.7 after 8 hours (all P = .002 and P = .04, respectively, compared with control). No effect was noted with pepsin at 2 hours. Taken together, these results demonstrate that despite the fact that acidic pH decreases cell viability, Muc5b transcription is induced by a short, transient acid exposure in mMEECs in vitro.

Place holder to copy figure label and caption
Figure 2.

Expression of Muc5b in mouse middle ear epithelial cells grown at an air-liquid interface and exposed to acidic pH for 30 minutes followed by 8 hours of immersion in serum-free media as measured by real-time reverse-transcriptase polymerase chain reaction. A, Absence of pepsin; B, presence of 2 mg/mL of pepsin. There is a 1.88-fold and 5.81-fold increase over neutral pH control with pH values of 5.7 and 4, respectively. Asterisk indicates P < .05 compared with neutral pH. The addition of 2 mg/mL of porcine pepsin mitigated the effect at pH 4 but enhanced the effect at pH 5.7 (P < .05 compared with neutral pH). Bar graphs without pepsin are shaded. Error bars indicate standard error.

Graphic Jump Location

To determine whether the observed increases in Muc5b mRNA levels with acidic pH were owing to increased transcriptional regulation, studies were performed to determine whether acidic pH increased promoter activity of a −1785-bp luciferase reporter construct. Luciferase assays (Figure 3) demonstrated statistically significant 1.7-fold, 1.40-fold, and 5.41-fold relative luciferase unit activation of the −1785Muc5bLuc promoter construct in mMEEC with pH values of 6 (P < .001), 5 (P = .01), and 4 (P = .002), respectively, compared with neutral pH without pepsin. Similar to previous data, the addition of pepsin somewhat mitigated the effects at pH 4 (which reduced the fold activation to 3.8), but increased promoter effects were still noted. The results suggest that the observed increase in Muc5b mRNA expression induced by acidic pH (Figure 2A) is at least partially regulated at the transcriptional level.

Place holder to copy figure label and caption
Figure 3.

Normalized Muc5b promoter activity as measured by dual luciferase assay and standardized to normalized PGL3 promoter activity after exposure to acidic pH and control (pH 7.6, 6, 5, and 4) with or without 2 mg/mL of porcine pepsin for 30 minutes and then serum-free media for 7.5 hours. A 5.41-fold increase over control at pH 4 was noted, which was somewhat mitigated with the addition of pepsin (3.8-fold). Asterisks indicate P < .05 compared with neutral pH. Minimal effects were noted at higher pH levels. Bar graphs without pepsin are shaded. Error bars indicate standard error; RLU, relative luciferase units.

Graphic Jump Location

Pepsin has been found in the middle ear of pediatric patients with OM with effusion and recurrent acute OM at levels higher than those of control individuals (patients with healthy middle ears undergoing cochlear implant surgery and having saline tympanic lavage).2,3,57,27 Because this result has only recently been demonstrated, the mechanisms by which reflux contributes to middle ear disease have yet to be elucidated. Muc5b is preferentially upregulated in OM with effusion13,14,28,29 and thus can be assayed for in vitro to infer whether pathologically relevant stimulants contribute to OM.

Real-time RT-PCR data showed a statistically significant increased acidic dose stimulation effect on Muc5b transcription at 8 hours after a short bolus of acid. This finding suggests that a mechanism by which refluxate contributes to middle ear effusions is by an effect on gene regulation. The refluxate induces the transcriptional upregulation of the highly viscous mucin Muc5b, perhaps thus ultimately leading to “glue ear.” Moreover, luciferase data indicate that gastric reflux indeed may signal intracellularly to directly enhance mucin gene promoter activity. This is the first report, to our knowledge, of either of these findings in middle ear cell systems. Our results are in line with those of Samuels et al,19 which showed that a similar course of exposure induced the transcription of Muc5ac in laryngeal airway epithelium at pH 2 and that the presence of pepsin abated this effect. Ongoing experiments in our laboratory are being performed to determine whether the increased expression of Muc5b mRNA translates into increased production of Muc5b mucin in mMEEC secretions.

Pepsin has proteolytic activity with a maximum active range at pH 2.5 to 4.5.4 Some collagenase activity remains at pH 5.5, but at pH 7.0 pepsin begins to denature. Importantly, at pH 5.7 pepsin showed enhancement of the acid effect on Muc5b mRNA levels at 8 hours (Figure 2). Reasons for this result are unclear, but a pH of 5.7 is more relevant to what has been found in the middle ear, where the pH levels of effusions have been reported to range from 6.0 to 7.6.5 Therefore, pepsin should have minimal, if any, activity in the middle ear and should be starting to denature. If pepsin plays a pathologic role in OM, it must be as transient as the reflux episode itself.

The pepsin used in this study was porcine, whereas the cells were murine. However, pepsin has evolved to have proteolytic activity against consumed matter, not necessarily an animal's own epithelial cell layer, and comparative biochemical studies have established that there are striking structural similarities and conservation across species. Despite this, there are also phylogenetic functional protein differences.30 This finding is a limitation of our study. The dose of pepsin used in our study, 2 mg/mL, is high. This pepsin dose was used because, at a concentration of 2 mg/mL, pepsin in solution has the same enzymatic activity as pepsin from crude gastric juice.31 Patients with symptoms of Barrett esophagus while supine were found to have a pepsin concentration of 300 μg/mL in their esophagus.32 Thus, we selected this dose because the enzymatic activity of pepsin remains physiologic, and the higher dose theoretically should increase the likelihood of noticing an effect.

Interestingly, our results indeed showed that pepsin conferred improved cell viability to acidic pH exposure. How this result exactly translates to the clinical condition of acid reflux into the middle ear is unclear, but the findings suggest that perhaps pepsin may have a protective effect through digestion of other proteins, either in the cells themselves or in the media in vitro, or by affecting proteins important in the inflammatory response in vivo. Another possibility is that the mitigating effect may be unrelated to the normal biological activity of pepsin, as previously mentioned. Future experimenters could consider using an inactive form of pepsin as a control or adding pepsinogen as the precursor. As demonstrated by Jiang et al26 in esophageal epithelium, cell viability after exposure to acid was found to be directly proportional to the pH, which implies that the acid itself is the pathologic agent in refluxate. Along the same lines, addition of pepsin did not significantly alter the acid effects on Muc5b transcription or promoter activity. Thus, although pepsin may not be the pathologic agent in reflux, it may be a useful marker for detecting the presence of refluxate in the middle ear.

Notably, the effects of pH 4 on Muc5b transcription as measured by RT-PCR were mitigated by the addition of pepsin, which instead enhanced the effects of pH 5.7 on Muc5b transcription. The reasons for this are unclear, but it is possible that dissolved pepsin in solution is somehow chelating or neutralizing the acid, effectively reducing its potency or protecting the cells from noxious acidic intracellular effects. However, the addition of pepsin to the media did not measurably alter the adjusted pH levels of the media. Finally, a limitation of our study is that the luciferase assays were performed on mMEECs grown on plastic, whereas RT-PCR measures of gene transcription were performed on differentiated cells grown in an ALI. Admittedly, in our hands it has proven difficult to transiently transfect the mMEECs after 14 days of ALI-differentiating conditions. It appears that the transfection process is either toxic to the differentiated cells or gene transfer is not efficient in these. At the same time though, we have found that measures of Muc5b mRNA production are clearly more robust when the cells are differentiated. This makes sense because in ALI there are more goblet cells present, which ultimately are the cells responsible for producing mucin.

In conclusion, the relationship of acid reflux to OM pathogenesis remains unclear. Causality has never been demonstrated for either acidic pH or pepsin. Our current in vitro data suggest that only reflux agents may play a role in the increase of mucin abundance in the middle ear. In summary, we show that acidic pH reduces mMEEC viability but induces Muc5b transcription and promoter activation in vitro, which perhaps explains how laryngopharyngeal reflux can contribute to OM. Furthermore, pepsin itself had minimal effects on Muc5b gene expression, which indicates perhaps that acid is a more likely pathologic component of gastric juice in the middle ear.

Correspondence: Diego Preciado, MD, PhD, Division of Pediatric Otolaryngology–Head and Neck Surgery, Children's National Medical Center, 111 Michigan Ave NW, Washington, DC 20010 (dpreciad@cnmc.org).

Submitted for Publication: April 2, 2009; final revision received July 7, 2009; accepted August 3, 2009.

Author Contributions: Drs Block and Preciado had full access to all the data in the study and take responsibility for the integrity of the data and the accuracy of the data analysis. Study concept and design: Block, Kuo, Escobar, Rose, and Preciado. Acquisition of data: Block, Kuo, Zalzal, and Preciado. Analysis and interpretation of data: Block, Kuo, Rose, and Preciado. Drafting of the manuscript: Block, Kuo, and Preciado. Critical revision of the manuscript for important intellectual content: Block, Kuo, Zalzal, Escobar, Rose, and Preciado. Statistical analysis: Kuo and Preciado. Obtained funding: Rose and Preciado. Administrative, technical, and material support: Block, Kuo, Zalzal, Escobar, Rose, and Preciado. Study supervision: Rose and Preciado.

Financial Disclosure: None reported.

Funding/Support: This work was supported by a Triologic Society Career Development Award and by an Avery Scholar Research Award from Children's National Medical Center (Dr Preciado).

Previous Presentation: This study was presented at the American Society for Pediatric Otolaryngology Annual Meeting; May 25, 2009; Seattle, Washington.

Kerschner  J Otitis media. Kleigman  RNelson Textbook of Pediatrics. Philadelphia, PA WB Saunders2007;2632- 2646
Tasker  ADettmar  PWPanetti  MKoufman  JABirchall  JPPearson  JP Reflux of gastric juice and glue ear in children. Lancet 2002;359 (9305) 493
PubMed Link to Article
Tasker  ADettmar  PWPanetti  MKoufman  JABirchall  JPPearson  JP Is gastric reflux a cause of otitis media with effusion in children? Laryngoscope 2002;112 (11) 1930- 1934
PubMed Link to Article
Roberts  NB Review article: human pepsins—their multiplicity, function and role in reflux disease. Aliment Pharmacol Ther 2006;24 ((suppl 2)) 2- 9
PubMed Link to Article
Crapko  MKerschner  JESyring  MJohnston  N Role of extra-esophageal reflux in chronic otitis media with effusion. Laryngoscope 2007;117 (8) 1419- 1423
PubMed Link to Article
He  ZO'Reilly  RCBolling  L  et al.  Detection of gastric pepsin in middle ear fluid of children with otitis media. Otolaryngol Head Neck Surg 2007;137 (1) 59- 64
PubMed Link to Article
O'Reilly  RCHe  ZBloedon  E  et al.  The role of extraesophageal reflux in otitis media in infants and children. Laryngoscope 2008;118 (7, pt 2) ((suppl 116)) 1- 9
PubMed Link to Article
Sade  J Pathology and pathogenesis of serous otitis media. Arch Otolaryngol 1966;84 (3) 297- 305
PubMed Link to Article
Rose  MC Mucins: structure, function, and role in pulmonary diseases. Am J Physiol 1992;263 (4 pt 1) L413- L429
Gendler  SJSpicer  AP Epithelial mucin genes. Annu Rev Physiol 1995;57607- 634
PubMed Link to Article
Rose  MCVoynow  JA Respiratory tract mucin genes and mucin glycoproteins in health and disease. Physiol Rev 2006;86 (1) 245- 278
PubMed Link to Article
Rahimi  MPWatson  ARose  MC Characterization of mucin glycoproteins in middle ear effusions.  Poster presented at: Association for Research in Otolaryngology Annual Meeting February 16, 2009 Baltimore, MD
Lin  JTsuprun  VKawano  H  et al.  Characterization of mucins in human middle ear and eustachian tube. Am J Physiol Lung Cell Mol Physiol 2001;280 (6) L1157- L1167
Elsheikh  MNMahfouz  ME Up-regulation of MUC5AC and MUC5B mucin genes in nasopharyngeal respiratory mucosa and selective up-regulation of MUC5B in middle ear in pediatric otitis media with effusion. Laryngoscope 2006;116 (3) 365- 369
PubMed Link to Article
Kerschner  JE Mucin gene expression in human middle ear epithelium. Laryngoscope 2007;117 (9) 1666- 1676
PubMed Link to Article
Giebink  GSLe  CTPaparella  MM Epidemiology of otitis media with effusion in children. Arch Otolaryngol 1982;108 (9) 563- 566
PubMed Link to Article
Mariette  CPiessen  GLeteurtre  EHémon  BTriboulet  J-PVan Seuningen  I Activation of MUC1 mucin expression by bile acids in human esophageal adenocarcinomatous cells and tissues is mediated by the phosphatidylinositol 3-kinase. Surgery 2008;143 (1) 58- 71
PubMed Link to Article
van Roon  AHCMayne  GCWijnhoven  BPL  et al.  Impact of gastro-esophageal reflux on mucin mRNA expression in the esophageal mucosa. J Gastrointest Surg 2008;12 (8) 1331- 1340
PubMed Link to Article
Samuels  TLHandler  ESyring  ML  et al.  Mucin gene expression in human laryngeal epithelia: effect of laryngopharyngeal reflux. Ann Otol Rhinol Laryngol 2008;117 (9) 688- 695
Delehaye  EDore  MPBozzo  CMameli  LDelitala  GMeloni  F Correlation between nasal mucociliary clearance time and gastroesophageal reflux disease: our experience on 50 patients. Auris Nasus Larynx 2009;36 (2) 157- 161
PubMed Link to Article
Lang  IMHaworth  STMedda  BKRoerig  DLForster  HVShaker  R Airway responses to esophageal acidification. Am J Physiol Regul Integr Comp Physiol 2008;294 (1) R211- R219
PubMed Link to Article
White  DRHeavner  SBHardy  SMPrazma  J Gastroesophageal reflux and eustachian tube dysfunction in an animal model. Laryngoscope 2002;112 (6) 955- 961
PubMed Link to Article
Tsuchiya  KKim  YOndrey  FGLin  J Characterization of a temperature-sensitive mouse middle ear epithelial cell line. Acta Otolaryngol 2005;125 (8) 823- 829
PubMed Link to Article
Preciado  DLin  JWuertz  BRose  M Cigarette smoke activates NFκB and induces Muc5b expression in mouse middle ear cells. Laryngoscope 2008;118 (3) 464- 471
PubMed Link to Article
Choi  JYKim  CHLee  WSKim  HNSong  KSYoon  JH Ciliary and secretory differentiation of normal human middle ear epithelial cells. Acta Otolaryngol 2002;122 (3) 270- 275
PubMed Link to Article
Jiang  Z-RGong  JZhang  Z-NQiao  Z Influence of acid and bile acid on ERK activity, PPARγ expression and cell proliferation in normal human esophageal epithelial cells. World J Gastroenterol 2006;12 (15) 2445- 2449
He  ZO'Reilly  RCMehta  D Gastric pepsin in middle ear fluid of children with otitis media: clinical implications. Curr Allergy Asthma Rep 2008;8 (6) 513- 518
PubMed Link to Article
Lin  JTsuboi  YRimell  F  et al.  Expression of mucins in mucoid otitis media. J Assoc Res Otolaryngol 2003;4 (3) 384- 393
PubMed Link to Article
Kawano  HPaparella  MMHo  SB  et al.  Identification of MUC5B mucin gene in human middle ear with chronic otitis media. Laryngoscope 2000;110 (4) 668- 673
PubMed Link to Article
Carginale  VTrinchella  FCapasso  CScudiero  RRiggio  MParisi  E Adaptive evolution and functional divergence of pepsin gene family. Gene 2004;33381- 90
PubMed Link to Article
Ohrui  TYamaya  MSuzuki  T  et al.  Mechanisms of gastric juice–induced hyperpermeability of the cultured human tracheal epithelium. Chest 1997;111 (2) 454- 459
PubMed Link to Article
Gotley  DCMorgan  APBall  DOwen  RWCooper  MJ Composition of gastro-oesophageal refluxate. Gut 1991;32 (10) 1093- 1099
PubMed Link to Article


Place holder to copy figure label and caption
Figure 1.

Effect of pH on cell viability. A, 3-(4,5-dimethylthiazoyl-2-yl)-2,5-diphenyltetrazolium bromide colorimetric assay performed on mouse middle ear epithelial cells after exposure to acidic pH at 1, 2, 4, and 8 hours. B, The identical experiment was performed but with 2 mg/mL of porcine pepsin added. Results showed increased metabolic activity compared with acid alone at most pH levels, which implies a protective effect of pepsin. C, Data from panels A and B for pH 5.0 and 5.5, set apart to more clearly illustrate the protective effect of pepsin.

Graphic Jump Location
Place holder to copy figure label and caption
Figure 2.

Expression of Muc5b in mouse middle ear epithelial cells grown at an air-liquid interface and exposed to acidic pH for 30 minutes followed by 8 hours of immersion in serum-free media as measured by real-time reverse-transcriptase polymerase chain reaction. A, Absence of pepsin; B, presence of 2 mg/mL of pepsin. There is a 1.88-fold and 5.81-fold increase over neutral pH control with pH values of 5.7 and 4, respectively. Asterisk indicates P < .05 compared with neutral pH. The addition of 2 mg/mL of porcine pepsin mitigated the effect at pH 4 but enhanced the effect at pH 5.7 (P < .05 compared with neutral pH). Bar graphs without pepsin are shaded. Error bars indicate standard error.

Graphic Jump Location
Place holder to copy figure label and caption
Figure 3.

Normalized Muc5b promoter activity as measured by dual luciferase assay and standardized to normalized PGL3 promoter activity after exposure to acidic pH and control (pH 7.6, 6, 5, and 4) with or without 2 mg/mL of porcine pepsin for 30 minutes and then serum-free media for 7.5 hours. A 5.41-fold increase over control at pH 4 was noted, which was somewhat mitigated with the addition of pepsin (3.8-fold). Asterisks indicate P < .05 compared with neutral pH. Minimal effects were noted at higher pH levels. Bar graphs without pepsin are shaded. Error bars indicate standard error; RLU, relative luciferase units.

Graphic Jump Location



Kerschner  J Otitis media. Kleigman  RNelson Textbook of Pediatrics. Philadelphia, PA WB Saunders2007;2632- 2646
Tasker  ADettmar  PWPanetti  MKoufman  JABirchall  JPPearson  JP Reflux of gastric juice and glue ear in children. Lancet 2002;359 (9305) 493
PubMed Link to Article
Tasker  ADettmar  PWPanetti  MKoufman  JABirchall  JPPearson  JP Is gastric reflux a cause of otitis media with effusion in children? Laryngoscope 2002;112 (11) 1930- 1934
PubMed Link to Article
Roberts  NB Review article: human pepsins—their multiplicity, function and role in reflux disease. Aliment Pharmacol Ther 2006;24 ((suppl 2)) 2- 9
PubMed Link to Article
Crapko  MKerschner  JESyring  MJohnston  N Role of extra-esophageal reflux in chronic otitis media with effusion. Laryngoscope 2007;117 (8) 1419- 1423
PubMed Link to Article
He  ZO'Reilly  RCBolling  L  et al.  Detection of gastric pepsin in middle ear fluid of children with otitis media. Otolaryngol Head Neck Surg 2007;137 (1) 59- 64
PubMed Link to Article
O'Reilly  RCHe  ZBloedon  E  et al.  The role of extraesophageal reflux in otitis media in infants and children. Laryngoscope 2008;118 (7, pt 2) ((suppl 116)) 1- 9
PubMed Link to Article
Sade  J Pathology and pathogenesis of serous otitis media. Arch Otolaryngol 1966;84 (3) 297- 305
PubMed Link to Article
Rose  MC Mucins: structure, function, and role in pulmonary diseases. Am J Physiol 1992;263 (4 pt 1) L413- L429
Gendler  SJSpicer  AP Epithelial mucin genes. Annu Rev Physiol 1995;57607- 634
PubMed Link to Article
Rose  MCVoynow  JA Respiratory tract mucin genes and mucin glycoproteins in health and disease. Physiol Rev 2006;86 (1) 245- 278
PubMed Link to Article
Rahimi  MPWatson  ARose  MC Characterization of mucin glycoproteins in middle ear effusions.  Poster presented at: Association for Research in Otolaryngology Annual Meeting February 16, 2009 Baltimore, MD
Lin  JTsuprun  VKawano  H  et al.  Characterization of mucins in human middle ear and eustachian tube. Am J Physiol Lung Cell Mol Physiol 2001;280 (6) L1157- L1167
Elsheikh  MNMahfouz  ME Up-regulation of MUC5AC and MUC5B mucin genes in nasopharyngeal respiratory mucosa and selective up-regulation of MUC5B in middle ear in pediatric otitis media with effusion. Laryngoscope 2006;116 (3) 365- 369
PubMed Link to Article
Kerschner  JE Mucin gene expression in human middle ear epithelium. Laryngoscope 2007;117 (9) 1666- 1676
PubMed Link to Article
Giebink  GSLe  CTPaparella  MM Epidemiology of otitis media with effusion in children. Arch Otolaryngol 1982;108 (9) 563- 566
PubMed Link to Article
Mariette  CPiessen  GLeteurtre  EHémon  BTriboulet  J-PVan Seuningen  I Activation of MUC1 mucin expression by bile acids in human esophageal adenocarcinomatous cells and tissues is mediated by the phosphatidylinositol 3-kinase. Surgery 2008;143 (1) 58- 71
PubMed Link to Article
van Roon  AHCMayne  GCWijnhoven  BPL  et al.  Impact of gastro-esophageal reflux on mucin mRNA expression in the esophageal mucosa. J Gastrointest Surg 2008;12 (8) 1331- 1340
PubMed Link to Article
Samuels  TLHandler  ESyring  ML  et al.  Mucin gene expression in human laryngeal epithelia: effect of laryngopharyngeal reflux. Ann Otol Rhinol Laryngol 2008;117 (9) 688- 695
Delehaye  EDore  MPBozzo  CMameli  LDelitala  GMeloni  F Correlation between nasal mucociliary clearance time and gastroesophageal reflux disease: our experience on 50 patients. Auris Nasus Larynx 2009;36 (2) 157- 161
PubMed Link to Article
Lang  IMHaworth  STMedda  BKRoerig  DLForster  HVShaker  R Airway responses to esophageal acidification. Am J Physiol Regul Integr Comp Physiol 2008;294 (1) R211- R219
PubMed Link to Article
White  DRHeavner  SBHardy  SMPrazma  J Gastroesophageal reflux and eustachian tube dysfunction in an animal model. Laryngoscope 2002;112 (6) 955- 961
PubMed Link to Article
Tsuchiya  KKim  YOndrey  FGLin  J Characterization of a temperature-sensitive mouse middle ear epithelial cell line. Acta Otolaryngol 2005;125 (8) 823- 829
PubMed Link to Article
Preciado  DLin  JWuertz  BRose  M Cigarette smoke activates NFκB and induces Muc5b expression in mouse middle ear cells. Laryngoscope 2008;118 (3) 464- 471
PubMed Link to Article
Choi  JYKim  CHLee  WSKim  HNSong  KSYoon  JH Ciliary and secretory differentiation of normal human middle ear epithelial cells. Acta Otolaryngol 2002;122 (3) 270- 275
PubMed Link to Article
Jiang  Z-RGong  JZhang  Z-NQiao  Z Influence of acid and bile acid on ERK activity, PPARγ expression and cell proliferation in normal human esophageal epithelial cells. World J Gastroenterol 2006;12 (15) 2445- 2449
He  ZO'Reilly  RCMehta  D Gastric pepsin in middle ear fluid of children with otitis media: clinical implications. Curr Allergy Asthma Rep 2008;8 (6) 513- 518
PubMed Link to Article
Lin  JTsuboi  YRimell  F  et al.  Expression of mucins in mucoid otitis media. J Assoc Res Otolaryngol 2003;4 (3) 384- 393
PubMed Link to Article
Kawano  HPaparella  MMHo  SB  et al.  Identification of MUC5B mucin gene in human middle ear with chronic otitis media. Laryngoscope 2000;110 (4) 668- 673
PubMed Link to Article
Carginale  VTrinchella  FCapasso  CScudiero  RRiggio  MParisi  E Adaptive evolution and functional divergence of pepsin gene family. Gene 2004;33381- 90
PubMed Link to Article
Ohrui  TYamaya  MSuzuki  T  et al.  Mechanisms of gastric juice–induced hyperpermeability of the cultured human tracheal epithelium. Chest 1997;111 (2) 454- 459
PubMed Link to Article
Gotley  DCMorgan  APBall  DOwen  RWCooper  MJ Composition of gastro-oesophageal refluxate. Gut 1991;32 (10) 1093- 1099
PubMed Link to Article


Also Meets CME requirements for:
Browse CME for all U.S. States
Accreditation Information
The American Medical Association is accredited by the Accreditation Council for Continuing Medical Education to provide continuing medical education for physicians. The AMA designates this journal-based CME activity for a maximum of 1 AMA PRA Category 1 CreditTM per course. Physicians should claim only the credit commensurate with the extent of their participation in the activity. Physicians who complete the CME course and score at least 80% correct on the quiz are eligible for AMA PRA Category 1 CreditTM.
Note: You must get at least of the answers correct to pass this quiz.
Please click the checkbox indicating that you have read the full article in order to submit your answers.
Your answers have been saved for later.
You have not filled in all the answers to complete this quiz
The following questions were not answered:
Sorry, you have unsuccessfully completed this CME quiz with a score of
The following questions were not answered correctly:
Commitment to Change (optional):
Indicate what change(s) you will implement in your practice, if any, based on this CME course.
Your quiz results:
The filled radio buttons indicate your responses. The preferred responses are highlighted
For CME Course: A Proposed Model for Initial Assessment and Management of Acute Heart Failure Syndromes
Indicate what changes(s) you will implement in your practice, if any, based on this CME course.


Some tools below are only available to our subscribers or users with an online account.

8 Citations

Related Content

Customize your page view by dragging & repositioning the boxes below.

Articles Related By Topic
Related Collections